genome

AI-powered genomic analysis — now available in US, UK & EU

Genomegenome
SK
ML
JR
★★★★★4.9/5

YourDNAholdsanswers.Wedecodethem.

Get an AI-powered health report from your DNA. 576 variants, 88 medications, 60 risk scores — not the 2% others test.

Made possible by 200+ researchers from
NVIDIAStanfordNatureHarvardMITOpenAIArc InstituteUC BerkeleyCambridgeNIHBroad InstituteUCSFEMBL-EBISangerHuggingFaceClinVarPharmGKBgnomAD
NVIDIAStanfordNatureHarvardMITOpenAIArc InstituteUC BerkeleyCambridgeNIHBroad InstituteUCSFEMBL-EBISangerHuggingFaceClinVarPharmGKBgnomAD
Genomic AnalysisVariant ScoringPharmacogenomics98% Coverage12 Cancers Screened60 Risk Scores400+ ConditionsPrivacy-FirstBRCA1 ScreeningNon-Coding RegionsAI-PoweredDrug Response
Genomic AnalysisVariant ScoringPharmacogenomics98% Coverage12 Cancers Screened60 Risk Scores400+ ConditionsPrivacy-FirstBRCA1 ScreeningNon-Coding RegionsAI-PoweredDrug Response
Your report includes

Discover what's hiding in your DNA

11 dimensions of your health — from cancer screening to drug response — decoded from a single sample.

Cancer Panel

12 cancers screened. Not 3.

A complete genetic cancer panel — from breast and prostate to pancreas and melanoma. 23andMe covers 3. We cover 12.

"Breast cancer risk: above average — BRCA1 variant detected, recommend clinical confirmation"

BreastProstateColorectalLung+2
12Cancers
60Risk scores
BRCAIncluded
Drug Response

Know which medications work for you

Your report shows how your genes affect 88 medications — with clear dosage guidance for each.

"Clopidogrel: Poor metabolizer — consider alternative"

AntidepressantsStatinsPain reliefBlood thinners+1
88Medications
22Pharmacogenes
FDAAligned
AI Variant Scoring

Answers where others say 'unknown'

Our AI reads regions other tests ignore — including frameshift mutations that DNA chips miss entirely.

"BRCA1 185delAG detected — frameshift mutation missed by standard chips"

Non-coding regionsFrameshift mutationsNovel variantsRegulatory
50K+Variants scored
95%AUROC
IndelsDetected
Metabolic Profile

Your blood test, predicted by DNA

LDL, HDL, triglycerides, HbA1c, BMI predisposition, celiac risk — your metabolic blueprint before the blood draw.

"Genetically elevated LDL — discuss early statin screening with your doctor"

LDL cholesterolHDLTriglyceridesHbA1c+2
32Nutrient genes
23Fitness traits
LDL/HDLPredicted
Women's Health

Built for women

Ovarian cancer, endometrial cancer, endometriosis, fibroids, BRCA — because women deserve more than a generic report.

"Endometriosis risk: elevated — early monitoring recommended"

Ovarian cancerEndometrial cancerEndometriosisFibroids+1
5Conditions
BRCAFull panel
EndoRisk score
Mental Health

7 conditions. Your brain, decoded.

Depression, anxiety, ADHD, bipolar, insomnia, autism spectrum — genetic predispositions that help you understand yourself.

"Slow COMT variant — higher dopamine baseline, better focus under calm conditions"

DepressionAnxietyADHDBipolar+2
7Conditions
17Neuro genes
COMTDopamine
Autoimmune Panel

9 autoimmune conditions screened

Lupus, rheumatoid arthritis, MS, Crohn's, celiac, psoriasis, eczema, vitiligo, thyroid — the answers many patients wait years for.

"Elevated risk for celiac disease — consider screening even without symptoms"

LupusRheumatoid arthritisMSCrohn's+2
9Conditions
PGSRisk scores
HLATyped
Skin & Aging

Your skin, decoded

Collagen, UV sensitivity, baldness risk, psoriasis, eczema, vitiligo — skincare and dermatology based on your DNA.

"High UV sensitivity + low collagen turnover — prioritize SPF 50+ daily"

UV sensitivityCollagenBaldnessPsoriasis+2
15Skin genes
UVSensitivity
MPBBaldness
Carrier Status

Plan with confidence

Carrier status for 28+ conditions — now with frameshift detection for CFTR ΔF508, BRCA1 185delAG, and more.

"CFTR ΔF508 carrier detected — important for family planning"

Cystic fibrosisSMATay-SachsSickle cell+1
28+Conditions
IndelsDetected
CFTRΔF508
Longevity

Aging, Alzheimer's, Parkinson's

Telomere markers, sirtuin pathway, plus Alzheimer's and Parkinson's risk scores. Plan your healthspan.

"APOE ε3/ε4 — moderately elevated Alzheimer's risk, lifestyle interventions recommended"

Alzheimer'sParkinson'sTelomeresFOXO3+1
12Aging genes
APOEAlzheimer's
LRRK2Parkinson's
Eye Health

Protect your vision

Age-related macular degeneration and glaucoma — two leading causes of vision loss, now in your DNA report.

"Elevated AMD risk — annual eye exams recommended after 45"

Macular degenerationGlaucoma
2Conditions
AMDScreened
50+At-risk age
The Report

Not just data. Answers.

Here's what you'll find in your report.

82out of 100
Healthy

One score. Your whole genome.

596 genetic markers analyzed, 60 polygenic risk scores calculated, distilled into a single number that tells you where you stand. Green means go. Orange means watch. Red means act.

18Normal
5Monitor
2Action

Clear actions. Not guesswork.

Other tests give you raw data and say "talk to your doctor." We tell you exactly what to discuss — ranked by urgency.

CYP2D6⚡ Action

Poor metabolizer — codeine & tramadol won't work for you

APOE ε4💬 Discuss

Elevated Alzheimer's risk — lifestyle changes can reduce it by 40%

MTHFR💬 Discuss

Reduced folate metabolism — consider methylfolate supplement

Clopidogrel
Switch needed
Simvastatin
Lower dose
Codeine
Won't work
Ibuprofen
Standard dose

Will your medications work?

88 medications checked against your DNA. For each one: will it work, does it need a dose adjustment, or should you avoid it entirely. Print it and bring it to your next appointment.

Get your drug response report

A roadmap for every decade.

Your DNA doesn't change, but what matters at 30 is different from what matters at 50. We map out what to watch — and when — so nothing catches you off guard.

Now
  • Inform doctor re: CYP2D6
  • Start methylfolate
40+
  • Cardiovascular screening
  • Cholesterol monitoring
50+
  • Cognitive health check
  • Annual skin screening
AI Deep Scan

We found 3 things others missed.

Our AI scanned 50,000+ positions in your genome that no traditional test covers. It found 3 variants worth your attention — variants that would have been labeled "unknown" everywhere else.

PALB2
Breast cancer risk
87%
CHEK2
DNA repair pathway
72%
RAD51C
Ovarian cancer associated
65%
How it works

Three steps to decode your genome

From upload to insight in as little as 24 hours

01

Upload or Order

Upload your existing raw DNA file or order a premium saliva collection kit delivered to your door.

Drag & drop your raw DNA fileSupports VCF, 23andMe, AncestryDNAOr order a home collection kit
02

AI Analysis

Our Evo2-powered engine analyzes 98% of your genome — not just the 2% traditional tests cover.

7 billion base pairs scoredNon-coding & regulatory regionsNovel variant detection via AI
03

Your Report

A comprehensive, actionable report with health risks, drug response, and ancestry insights.

Personalized health risk insightsPharmacogenomics recommendationsDownloadable PDF & dashboard
Compatible with
23andMe
AncestryDNA
Nebula
MyHeritage
.VCF
How it works

An AI that reads DNA.That didn't exist before.

Until now, computers could only look at the 2% of your DNA that science already understood. Our AI scans all of it — including mutations that standard DNA chips physically cannot detect.

1

We scan every letter of your DNA

Your DNA is a sequence of 3 billion letters. Traditional tests only read 2% of them — the parts science already understands.

Our AI was trained on the DNA of every living species on Earth. It learned what "normal" DNA looks like — so it can spot when something in yours is different.

🔬

Traditional tests

Read ~20,000 known spots. Ignore the rest.

2%
🧬

Our AI analysis

Reads everything. Flags anything unusual.

98%

Powered by Evo2, the largest DNA language model — trained on 3.2 trillion genetic letters from bacteria, plants, animals, and humans.

2

It spots the "typos"

When a letter in your DNA is different from what the AI expects, it raises a flag — like finding a spelling mistake in a legal document.

Healthy version
...ATGCCTGGATAC...Sounds normal
Your version
...ATGCCTAGATAC...Sounds off
⚠️One letter changed — and the AI flagged it as suspicious.
Like a typo in a sentence that changes the meaning entirely.
3

Then we investigate what it means

A "typo" in your DNA doesn't always mean something bad. So we check it against the world's largest medical databases to understand if it matters — and why.

🔍

Is this change known?

We check against 2 million classified changes from hospitals worldwide.

ClinVar — NIH database

📈

What does research say?

We look at 313,000 studies linking DNA changes to health conditions.

GWAS Catalog

🌍

How rare is it?

We compare yours against 6.8 million people. Rare changes deserve more attention.

gnomAD population data

🦎

Has nature ever touched it?

If this spot hasn't changed across species in 100 million years, it's probably important.

Cross-species conservation

4

You get a clear answer

Other tests say "unknown significance" on most of your results.

We combine the AI's detection with medical databases to give you a plain-language explanation — what was found, what it might mean, and what to discuss with your doctor.

That's why we catch things others miss — including changes never seen before.

Testimonials

Real people. Real insights.

Real people, real insights from their genomic analysis

After years of trying different antidepressants, I finally understood why none of them worked. Turns out I'm a poor metabolizer for most SSRIs. Brought the report to my psychiatrist and we found the right one in weeks instead of months.

Rachel K.

Rachel K.

Portland, OR

I was nervous about uploading my DNA anywhere after the 23andMe bankruptcy. The fact that the file never leaves my browser made me actually go through with it. And the report was way more useful than what 23andMe ever gave me.

Daniel S.

Daniel S.

London, UK

I'd been dealing with brain fog for years. The report showed I have a slow COMT variant — my doctor had never tested for it. Changed my supplement routine and I genuinely feel sharper.

Megan T.

Megan T.

Austin, TX

I tried uploading my raw data to ChatGPT first. It told me I had three diseases I definitely don't have. This report actually cites real medical databases for every finding. Night and day difference.

James L.

James L.

Toronto, CA

My mom had breast cancer, so I was terrified of my BRCA results. What I appreciated is that the report didn't just scare me — it told me exactly which screenings to request and what to ask my doctor. That's what I needed.

Sofia N.

Sofia N.

Barcelona, ES

I'm a naturopath and I've used Promethease, SelfDecode, and PureGenomics with patients. This is the first report I don't need to translate into English for them. They actually understand it.

Dr. Laura H.

Dr. Laura H.

Denver, CO

My Promethease report just vanished one day — they deleted everyone's files and wanted me to pay again. Switched to this and honestly the report is 10x more useful. Promethease just gave me a wall of data I couldn't read.

Alex W.

Alex W.

Chicago, IL

I've been dealing with chronic fatigue and my doctor couldn't figure it out. Report showed MTHFR C677T homozygous — my body wasn't converting folate properly. Started methylfolate and within two weeks I felt like a different person.

Hannah B.

Hannah B.

Melbourne, AU

My wife and I used this before planning our second child. Found out we're both carriers for a recessive condition we had no idea about. Our genetic counselor said the report was thorough enough to work from directly.

Kevin D.

Kevin D.

Amsterdam, NL

I'm a biohacker and I've spent years optimizing supplements based on guesswork. This report finally gave me the actual data — slow COMT, fast MAO-A, poor methylation. Now my stack is based on my genes, not Reddit threads.

Chris M.

Chris M.

San Diego, CA

I was paying $120/year for SelfDecode and half the results said 'insufficient data.' This was a one-time payment and covered everything including pharmacogenomics. No subscription, no upsells. Exactly what I wanted.

Priya S.

Priya S.

New York, NY

Codeine literally does nothing for me — I always thought I was being dramatic. Report confirmed I'm an ultra-rapid CYP2D6 metabolizer. Printed the drug table and my doctor immediately switched my pain management plan.

Tom R.

Tom R.

Dublin, IE

After years of trying different antidepressants, I finally understood why none of them worked. Turns out I'm a poor metabolizer for most SSRIs. Brought the report to my psychiatrist and we found the right one in weeks instead of months.

Rachel K.

Rachel K.

Portland, OR

I was nervous about uploading my DNA anywhere after the 23andMe bankruptcy. The fact that the file never leaves my browser made me actually go through with it. And the report was way more useful than what 23andMe ever gave me.

Daniel S.

Daniel S.

London, UK

I'd been dealing with brain fog for years. The report showed I have a slow COMT variant — my doctor had never tested for it. Changed my supplement routine and I genuinely feel sharper.

Megan T.

Megan T.

Austin, TX

I tried uploading my raw data to ChatGPT first. It told me I had three diseases I definitely don't have. This report actually cites real medical databases for every finding. Night and day difference.

James L.

James L.

Toronto, CA

My mom had breast cancer, so I was terrified of my BRCA results. What I appreciated is that the report didn't just scare me — it told me exactly which screenings to request and what to ask my doctor. That's what I needed.

Sofia N.

Sofia N.

Barcelona, ES

I'm a naturopath and I've used Promethease, SelfDecode, and PureGenomics with patients. This is the first report I don't need to translate into English for them. They actually understand it.

Dr. Laura H.

Dr. Laura H.

Denver, CO

My Promethease report just vanished one day — they deleted everyone's files and wanted me to pay again. Switched to this and honestly the report is 10x more useful. Promethease just gave me a wall of data I couldn't read.

Alex W.

Alex W.

Chicago, IL

I've been dealing with chronic fatigue and my doctor couldn't figure it out. Report showed MTHFR C677T homozygous — my body wasn't converting folate properly. Started methylfolate and within two weeks I felt like a different person.

Hannah B.

Hannah B.

Melbourne, AU

My wife and I used this before planning our second child. Found out we're both carriers for a recessive condition we had no idea about. Our genetic counselor said the report was thorough enough to work from directly.

Kevin D.

Kevin D.

Amsterdam, NL

I'm a biohacker and I've spent years optimizing supplements based on guesswork. This report finally gave me the actual data — slow COMT, fast MAO-A, poor methylation. Now my stack is based on my genes, not Reddit threads.

Chris M.

Chris M.

San Diego, CA

I was paying $120/year for SelfDecode and half the results said 'insufficient data.' This was a one-time payment and covered everything including pharmacogenomics. No subscription, no upsells. Exactly what I wanted.

Priya S.

Priya S.

New York, NY

Codeine literally does nothing for me — I always thought I was being dramatic. Report confirmed I'm an ultra-rapid CYP2D6 metabolizer. Printed the drug table and my doctor immediately switched my pain management plan.

Tom R.

Tom R.

Dublin, IE

After years of trying different antidepressants, I finally understood why none of them worked. Turns out I'm a poor metabolizer for most SSRIs. Brought the report to my psychiatrist and we found the right one in weeks instead of months.

Rachel K.

Rachel K.

Portland, OR

I was nervous about uploading my DNA anywhere after the 23andMe bankruptcy. The fact that the file never leaves my browser made me actually go through with it. And the report was way more useful than what 23andMe ever gave me.

Daniel S.

Daniel S.

London, UK

I'd been dealing with brain fog for years. The report showed I have a slow COMT variant — my doctor had never tested for it. Changed my supplement routine and I genuinely feel sharper.

Megan T.

Megan T.

Austin, TX

I tried uploading my raw data to ChatGPT first. It told me I had three diseases I definitely don't have. This report actually cites real medical databases for every finding. Night and day difference.

James L.

James L.

Toronto, CA

My mom had breast cancer, so I was terrified of my BRCA results. What I appreciated is that the report didn't just scare me — it told me exactly which screenings to request and what to ask my doctor. That's what I needed.

Sofia N.

Sofia N.

Barcelona, ES

I'm a naturopath and I've used Promethease, SelfDecode, and PureGenomics with patients. This is the first report I don't need to translate into English for them. They actually understand it.

Dr. Laura H.

Dr. Laura H.

Denver, CO

My Promethease report just vanished one day — they deleted everyone's files and wanted me to pay again. Switched to this and honestly the report is 10x more useful. Promethease just gave me a wall of data I couldn't read.

Alex W.

Alex W.

Chicago, IL

I've been dealing with chronic fatigue and my doctor couldn't figure it out. Report showed MTHFR C677T homozygous — my body wasn't converting folate properly. Started methylfolate and within two weeks I felt like a different person.

Hannah B.

Hannah B.

Melbourne, AU

My wife and I used this before planning our second child. Found out we're both carriers for a recessive condition we had no idea about. Our genetic counselor said the report was thorough enough to work from directly.

Kevin D.

Kevin D.

Amsterdam, NL

I'm a biohacker and I've spent years optimizing supplements based on guesswork. This report finally gave me the actual data — slow COMT, fast MAO-A, poor methylation. Now my stack is based on my genes, not Reddit threads.

Chris M.

Chris M.

San Diego, CA

I was paying $120/year for SelfDecode and half the results said 'insufficient data.' This was a one-time payment and covered everything including pharmacogenomics. No subscription, no upsells. Exactly what I wanted.

Priya S.

Priya S.

New York, NY

Codeine literally does nothing for me — I always thought I was being dramatic. Report confirmed I'm an ultra-rapid CYP2D6 metabolizer. Printed the drug table and my doctor immediately switched my pain management plan.

Tom R.

Tom R.

Dublin, IE

Drag to explore

Pricing

Start with what you have

From quick insights to complete genome analysis

Upload Report

Already have your DNA file?

99/one-time

Upload your existing 23andMe, AncestryDNA, or VCF file and get an AI-powered health report in 2 minutes. No kit needed.

  • 23andMe, AncestryDNA, MyHeritage, VCF
  • 576 variants across 15 categories
  • 88 medication interactions
  • 60 polygenic risk scores
  • Personalized nutrition insights
  • Doctor-ready PDF with references
  • Instant results
Most Complete

DNA Kit + Report

Don't have a DNA file? We handle everything.

299/one-time

We ship a saliva collection kit to your door. Full genome sequencing included — the most complete DNA health report available.

  • Saliva kit shipped to your door
  • Prepaid return envelope
  • Full genome sequencing (30× coverage)
  • 576+ variants analyzed by AI
  • 88 medication interactions
  • 60 polygenic risk scores
  • Personalized nutrition insights
  • Doctor-ready PDF with references
  • Results in ~2-3 weeks
All plans include a 30-day money-back guarantee
StripeSSL SecuredGDPR CompliantHIPAA

What's included in every plan

Secure Processing
Plain Language Report
PDF Export
Email Support
The Kit

Premium DNA collection

Designed for simplicity. Medical-grade quality.

€99
Everything includedKit + sequencing + AI report
Order Your Kit
Step 1

Open

Unbox your premium kit

Step 2

Collect

2-minute saliva sample

Step 3

Ship

Drop in any mailbox

Medical-grade tube
Prepaid return
Results in 6-8 weeks
Ships worldwide
FAQ

Questions? Answered.

Still have questions?

Our team is here to help. Reach out and we'll get back to you within 24 hours.

Privacy & security

Your DNA never leaves your control

We don't store, sell, or share your genetic data. Ever. Analysis happens in an encrypted pipeline and data is deleted after your report is generated.

End-to-End Encryption

Your genomic data is encrypted using AES-256 from the moment you upload it. Even we can't read your raw data.

GDPR & HIPAA Compliant

We follow the strictest data protection standards. Your genetic information is classified as sensitive personal data and treated accordingly.

Automatic Deletion

After your report is generated, raw genomic data is permanently deleted from our servers. You keep the insights, we keep nothing.

SOC 2GDPRHIPAAISO 27001

Trusted by researchers at

StanfordStanford
HarvardHarvard
MITMIT
Cambridge
NIH
Broad InstituteBroad Institute
Arc InstituteArc Institute
ACGTTAGCGCTAATCGCGAT
Limited early access — 47 spots remaining

Your genome is waiting.

Join thousands who've discovered what their genome reveals about their health, ancestry, and future.

SK
ML
JR
AW
+2,400 reports generated

No credit card required for upload analysis